ID: 980915784_980915787

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 980915784 980915787
Species Human (GRCh38) Human (GRCh38)
Location 4:139031971-139031993 4:139032002-139032024
Sequence CCAAAGTGCTGGGATTACAGGGG CACGCCCAGCCTCCCACTTGTGG
Strand - +
Off-target summary {0: 2655, 1: 199469, 2: 274982, 3: 197235, 4: 162301} {0: 1, 1: 0, 2: 0, 3: 18, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!