ID: 980920744_980920750

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 980920744 980920750
Species Human (GRCh38) Human (GRCh38)
Location 4:139083690-139083712 4:139083715-139083737
Sequence CCCCGAACGCGGGCAGCAGCGGC CTCCGGCCAGACAGCGTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 99} {0: 1, 1: 0, 2: 0, 3: 3, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!