ID: 980940765_980940769

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 980940765 980940769
Species Human (GRCh38) Human (GRCh38)
Location 4:139272025-139272047 4:139272052-139272074
Sequence CCAGCCTATCACATGGCCTAGTC TCTCTGTTTTTTTTTTTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 72} {0: 1, 1: 22, 2: 332, 3: 3975, 4: 21587}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!