ID: 980940767_980940770

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 980940767 980940770
Species Human (GRCh38) Human (GRCh38)
Location 4:139272041-139272063 4:139272073-139272095
Sequence CCTAGTCTCAATCTCTGTTTTTT GGCCTACACCTCAACTAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 86, 4: 990} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!