ID: 980959010_980959017

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 980959010 980959017
Species Human (GRCh38) Human (GRCh38)
Location 4:139455919-139455941 4:139455940-139455962
Sequence CCCAAGACTGTCCAGGTTTTAAA AAACTGGGTCTCACATCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 32, 4: 293} {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!