ID: 980985710_980985717

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 980985710 980985717
Species Human (GRCh38) Human (GRCh38)
Location 4:139692350-139692372 4:139692365-139692387
Sequence CCCAATTCCTTCTGGGAATACAG GAATACAGGGGATGTGCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 377} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!