ID: 980985710_980985723

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 980985710 980985723
Species Human (GRCh38) Human (GRCh38)
Location 4:139692350-139692372 4:139692400-139692422
Sequence CCCAATTCCTTCTGGGAATACAG CTGGCAAGCAGCTGAAGCAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 377} {0: 1, 1: 0, 2: 2, 3: 33, 4: 427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!