ID: 980988406_980988415

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 980988406 980988415
Species Human (GRCh38) Human (GRCh38)
Location 4:139717717-139717739 4:139717746-139717768
Sequence CCTGGGAGTGCACAGAAGGCAGC CTAGGACACGGAGGGAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 622} {0: 1, 1: 0, 2: 0, 3: 29, 4: 389}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!