ID: 981049058_981049060

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 981049058 981049060
Species Human (GRCh38) Human (GRCh38)
Location 4:140293180-140293202 4:140293198-140293220
Sequence CCCAACAGAATGTTTTCTCACAT CACATGAAATCTTAAACAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 378} {0: 1, 1: 1, 2: 0, 3: 13, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!