ID: 981049152_981049161

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 981049152 981049161
Species Human (GRCh38) Human (GRCh38)
Location 4:140293791-140293813 4:140293830-140293852
Sequence CCATGGCCACTATGGTGATGGAA ATTCATGGAGGCAGCCATCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 204} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!