ID: 981050428_981050430

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 981050428 981050430
Species Human (GRCh38) Human (GRCh38)
Location 4:140304347-140304369 4:140304377-140304399
Sequence CCACTGATTCTGGACATGTTGAT TTCTAGTTAGATATCCTGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 15, 4: 184} {0: 1, 1: 1, 2: 0, 3: 10, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!