ID: 981056205_981056212

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 981056205 981056212
Species Human (GRCh38) Human (GRCh38)
Location 4:140364597-140364619 4:140364646-140364668
Sequence CCCTTATCTATAAAGCTGCTCAT ACATCAGCTGCCAGTCTTAATGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 48, 3: 87, 4: 301} {0: 1, 1: 0, 2: 0, 3: 10, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!