ID: 981081624_981081628

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 981081624 981081628
Species Human (GRCh38) Human (GRCh38)
Location 4:140643618-140643640 4:140643637-140643659
Sequence CCGCAGGAACCGCCACAGGCACC CACCTCCACTGGCTCCTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 218} {0: 1, 1: 1, 2: 3, 3: 64, 4: 471}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!