ID: 981107741_981107743

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 981107741 981107743
Species Human (GRCh38) Human (GRCh38)
Location 4:140900342-140900364 4:140900367-140900389
Sequence CCAATTTACTGATGGGCTGACTA GGTGATGCTGATAACCTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 140} {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!