ID: 981125019_981125028

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 981125019 981125028
Species Human (GRCh38) Human (GRCh38)
Location 4:141095749-141095771 4:141095799-141095821
Sequence CCAAAAGAATTATTTAAAAACTT GAGAAAAATATAATCACTGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 143, 4: 1421} {0: 1, 1: 0, 2: 3, 3: 49, 4: 487}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!