ID: 981134098_981134108

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 981134098 981134108
Species Human (GRCh38) Human (GRCh38)
Location 4:141190442-141190464 4:141190492-141190514
Sequence CCCTAGGAACTGAGATCAACCCT ACTACAGTCCTATGACTACAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!