ID: 981134101_981134108

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 981134101 981134108
Species Human (GRCh38) Human (GRCh38)
Location 4:141190461-141190483 4:141190492-141190514
Sequence CCCTGGCCAACAGTCACCCAGAA ACTACAGTCCTATGACTACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 27, 4: 214} {0: 1, 1: 0, 2: 1, 3: 18, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!