ID: 981145355_981145359

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 981145355 981145359
Species Human (GRCh38) Human (GRCh38)
Location 4:141317596-141317618 4:141317621-141317643
Sequence CCCTTGCCAGTTCTTTTGCAAAA CTGGAGAAACAAAGTGTGCAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!