ID: 981176795_981176803

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 981176795 981176803
Species Human (GRCh38) Human (GRCh38)
Location 4:141691669-141691691 4:141691694-141691716
Sequence CCTTTGACTCCATGTCTCATATC GGGCAGGCTAATGCAAAGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 23, 3: 123, 4: 583}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!