ID: 981230035_981230041

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 981230035 981230041
Species Human (GRCh38) Human (GRCh38)
Location 4:142341948-142341970 4:142341971-142341993
Sequence CCCGTTCAACACCTTGACTATAG CCTTGTGAGACTCTGGGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 225} {0: 2, 1: 2, 2: 33, 3: 93, 4: 384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!