ID: 981260739_981260741

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 981260739 981260741
Species Human (GRCh38) Human (GRCh38)
Location 4:142715732-142715754 4:142715768-142715790
Sequence CCCAACATTTAGTGGCTTCAAAT TTGTTAACCATCTGCATTTTAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 40, 3: 293, 4: 1226} {0: 1, 1: 0, 2: 0, 3: 25, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!