ID: 981260740_981260746

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 981260740 981260746
Species Human (GRCh38) Human (GRCh38)
Location 4:142715733-142715755 4:142715781-142715803
Sequence CCAACATTTAGTGGCTTCAAATA GCATTTTAGGCTGGGACCATGGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 68, 3: 285, 4: 1072} {0: 1, 1: 0, 2: 0, 3: 18, 4: 530}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!