ID: 981331400_981331410

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 981331400 981331410
Species Human (GRCh38) Human (GRCh38)
Location 4:143513998-143514020 4:143514047-143514069
Sequence CCAGCGGCGGGAGCAACAGCAGC GGCGCAGGCGGTTGCGTCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 40, 4: 378} {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!