ID: 981340180_981340182

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 981340180 981340182
Species Human (GRCh38) Human (GRCh38)
Location 4:143613019-143613041 4:143613049-143613071
Sequence CCATCACTGCATGTTGCTTGTAT AGTTGCTAAAAAATGATAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 167} {0: 1, 1: 0, 2: 1, 3: 20, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!