ID: 981364746_981364752

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 981364746 981364752
Species Human (GRCh38) Human (GRCh38)
Location 4:143889373-143889395 4:143889412-143889434
Sequence CCACTGTCCCAGTGGGAAAGGAG TGGCTTTGCCACCAAATGGTTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 2, 3: 26, 4: 286} {0: 2, 1: 1, 2: 0, 3: 15, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!