ID: 981385862_981385869

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 981385862 981385869
Species Human (GRCh38) Human (GRCh38)
Location 4:144129845-144129867 4:144129885-144129907
Sequence CCACTGTCCCAGTGGGAAAGGAG GGCTTTGCCACCAAATGGTTGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 2, 3: 26, 4: 286} {0: 2, 1: 1, 2: 1, 3: 11, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!