ID: 981401091_981401098

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 981401091 981401098
Species Human (GRCh38) Human (GRCh38)
Location 4:144314243-144314265 4:144314278-144314300
Sequence CCAGTGGGAGTGTTTGTTCAGGA CCTTTCCCACTTCCACAGTTGGG
Strand - +
Off-target summary No data {0: 65, 1: 141, 2: 206, 3: 188, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!