ID: 981423531_981423533

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 981423531 981423533
Species Human (GRCh38) Human (GRCh38)
Location 4:144578321-144578343 4:144578358-144578380
Sequence CCAAGAAGCCACTTCAGGAAACT GCTAGCTCACCTATCAAGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!