ID: 981446542_981446544

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 981446542 981446544
Species Human (GRCh38) Human (GRCh38)
Location 4:144845791-144845813 4:144845809-144845831
Sequence CCAAAGGGAAGAACAGTGATTAT ATTATTGAGCAGACAGAGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!