ID: 981452166_981452172

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 981452166 981452172
Species Human (GRCh38) Human (GRCh38)
Location 4:144911227-144911249 4:144911255-144911277
Sequence CCTTTTCCCTGTGAAGGAGAAAG CTGTCAGCTCAGAGTGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 342} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!