ID: 981484382_981484388

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 981484382 981484388
Species Human (GRCh38) Human (GRCh38)
Location 4:145270094-145270116 4:145270112-145270134
Sequence CCCTTTGCATGTGAAGTGCCTTC CCTTCAAAGGGGTTTGCCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 224} {0: 1, 1: 0, 2: 3, 3: 15, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!