ID: 981509571_981509581

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 981509571 981509581
Species Human (GRCh38) Human (GRCh38)
Location 4:145541108-145541130 4:145541134-145541156
Sequence CCCTTCCTCCTCACCACTAACCT TGATGGGCAGGTTAGTGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 53, 4: 504} {0: 1, 1: 0, 2: 0, 3: 27, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!