ID: 981516913_981516926

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 981516913 981516926
Species Human (GRCh38) Human (GRCh38)
Location 4:145619472-145619494 4:145619501-145619523
Sequence CCCGCCGGGGGGCCAGCGCGGTC GGCGCCCCCTGGAGGATTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123} {0: 1, 1: 0, 2: 0, 3: 6, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!