ID: 981517402_981517407

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 981517402 981517407
Species Human (GRCh38) Human (GRCh38)
Location 4:145624835-145624857 4:145624857-145624879
Sequence CCTGATGGTTCTGGACAAGCCAA ATCCTCTGTAACCATGCTGGGGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 0, 3: 5, 4: 104} {0: 2, 1: 1, 2: 0, 3: 22, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!