ID: 981517402_981517407 |
View in Genome Browser |
Spacer: -1 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 981517402 | 981517407 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:145624835-145624857 | 4:145624857-145624879 |
| Sequence | CCTGATGGTTCTGGACAAGCCAA | ATCCTCTGTAACCATGCTGGGGG |
| Strand | - | + |
| Off-target summary | {0: 3, 1: 1, 2: 0, 3: 5, 4: 104} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||