|
Left Crispr |
Right Crispr |
| Crispr ID |
981524535 |
981524538 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:145696753-145696775
|
4:145696774-145696796
|
| Sequence |
CCGGGCACTGTGGCTCACACCTG |
TGTACTCTCAGTACTTCAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 352, 1: 12737, 2: 51498, 3: 121252, 4: 147279} |
{0: 1, 1: 9, 2: 247, 3: 4420, 4: 48603} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|