ID: 981526963_981526965

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 981526963 981526965
Species Human (GRCh38) Human (GRCh38)
Location 4:145716224-145716246 4:145716244-145716266
Sequence CCTTTCTCATGGTGACCTGGGAC GACACAGACTTCCTTCCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 195} {0: 1, 1: 0, 2: 3, 3: 48, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!