ID: 981530910_981530921

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 981530910 981530921
Species Human (GRCh38) Human (GRCh38)
Location 4:145752945-145752967 4:145752991-145753013
Sequence CCCACAATCGCTGTGCTCTCACT TGCCACGTGGCCGCTGCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 37, 3: 107, 4: 325} {0: 1, 1: 3, 2: 20, 3: 53, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!