ID: 981542758_981542765

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 981542758 981542765
Species Human (GRCh38) Human (GRCh38)
Location 4:145862406-145862428 4:145862449-145862471
Sequence CCCTGTTTGTGTAACATATAGAT AATTCTCACTGAGTTTTCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 206} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!