ID: 981546350_981546354

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 981546350 981546354
Species Human (GRCh38) Human (GRCh38)
Location 4:145898113-145898135 4:145898161-145898183
Sequence CCACCGCACTCTAGCCTGGGCTA AAGATTTATTATAATAACCACGG
Strand - +
Off-target summary {0: 5, 1: 412, 2: 13779, 3: 161985, 4: 271744} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!