ID: 981546353_981546355

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 981546353 981546355
Species Human (GRCh38) Human (GRCh38)
Location 4:145898141-145898163 4:145898162-145898184
Sequence CCAGACGCTGTCACAAACAAAAG AGATTTATTATAATAACCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 189, 4: 2205} {0: 1, 1: 0, 2: 2, 3: 18, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!