ID: 981568477_981568481

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 981568477 981568481
Species Human (GRCh38) Human (GRCh38)
Location 4:146126385-146126407 4:146126422-146126444
Sequence CCATAACAACTCTGACCAGTGAG AATGCCTTCTGAGGCTCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 157} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!