ID: 981599435_981599441

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 981599435 981599441
Species Human (GRCh38) Human (GRCh38)
Location 4:146469077-146469099 4:146469102-146469124
Sequence CCAGAAGGAGAGCACAGTCACTG GAGGCTAATGGCTTCTAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 232} {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!