ID: 981603806_981603811

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 981603806 981603811
Species Human (GRCh38) Human (GRCh38)
Location 4:146521809-146521831 4:146521849-146521871
Sequence CCTTGGTCCCTCCAGACATGCAG CCGATTGTAAAGTAAAGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 318} {0: 1, 1: 0, 2: 0, 3: 7, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!