ID: 981624316_981624323

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 981624316 981624323
Species Human (GRCh38) Human (GRCh38)
Location 4:146738584-146738606 4:146738620-146738642
Sequence CCACAGTTCCCGGTTCATAACTC ACAGTCTTTTGTCATAATGTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 40, 3: 92, 4: 209} {0: 2, 1: 39, 2: 88, 3: 140, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!