ID: 981624316_981624324

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 981624316 981624324
Species Human (GRCh38) Human (GRCh38)
Location 4:146738584-146738606 4:146738629-146738651
Sequence CCACAGTTCCCGGTTCATAACTC TGTCATAATGTTGGAGTGTTAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 40, 3: 92, 4: 209} {0: 1, 1: 0, 2: 0, 3: 9, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!