ID: 981628274_981628280

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 981628274 981628280
Species Human (GRCh38) Human (GRCh38)
Location 4:146786861-146786883 4:146786897-146786919
Sequence CCAGTGCTTTGGGAGGCCAAGGC GAGGCTAGGTGTTTGAGACCAGG
Strand - +
Off-target summary {0: 524, 1: 3708, 2: 64368, 3: 179830, 4: 225335} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!