ID: 981713623_981713633

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 981713623 981713633
Species Human (GRCh38) Human (GRCh38)
Location 4:147732315-147732337 4:147732361-147732383
Sequence CCCTGGAGTTCAGCGACTGCTAC GAGGATCCGCGCTCACGAAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 91} {0: 1, 1: 0, 2: 0, 3: 1, 4: 16}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!