ID: 981740384_981740386

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 981740384 981740386
Species Human (GRCh38) Human (GRCh38)
Location 4:147995695-147995717 4:147995719-147995741
Sequence CCAAAAATTTGCATGGTCCATCT TCTCTCTTTTTTTTTCATGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 164} {0: 1, 1: 0, 2: 34, 3: 485, 4: 4204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!