ID: 981747608_981747612

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 981747608 981747612
Species Human (GRCh38) Human (GRCh38)
Location 4:148066691-148066713 4:148066717-148066739
Sequence CCTGGGCTCACACCATGGCTTTC TCTTCTGTGTGACCTGGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 268} {0: 1, 1: 0, 2: 7, 3: 67, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!