ID: 981756513_981756520 |
View in Genome Browser |
Spacer: 14 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 981756513 | 981756520 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:148146040-148146062 | 4:148146077-148146099 |
| Sequence | CCAGTGAGCCAAGGAGAAGTAAG | AAGAAGAAGGGGAAGTGGGCTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 7, 3: 133, 4: 1287} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||